Pleomorphic medium-sized T-cell lymphoma following Hodgkin’s disease (nodular sclerosis type)

Archives of Pathology & Laboratory Medicine April 1, 1997 | Alain Gaulier; Francoise Teillet; Frederic Davi; Jerome Couturier; et al * We describe a 32-year-old woman who presented with Hodgkin’s disease, nodular sclerosis type II, subtype I, which necessitated several treatments over 11 years. The patient then developed pleomorphic, medium-sized T-cell lymphoma, which had a fatal outcome within 13 months. The role of radiotherapy, splenectomy, and chemotherapy in second tumor induction is compared with other sequential T-cell lymphomas. The significance of rare Epstein-Barr virus-infected cells during the T-cell lymphoma extension is discussed.

(Arch Pathol Lab Med. 1997;121:411-416) The most common malignancies to occur after a patient has been treated for Hodgkin’s disease are acute leukemias, non-Hodgkin’s lymphomas, and carcinomas of the lung.1-5 Lymphomas are usually of B-cell lineage and most frequently follow nodular lymphocyte-predominant or nodular sclerosis Hodgkin’s disease.2,6,7 Peripheral T-cell lymphomas have been described following type I lymphocyte-predominant Hodgkin’s disease,2>ll and, exceptionally, following type III (mixed cellularity).2l2l3 These previously described cases are summarized in Table 1. We report a case of Hodgkin’s disease, nodular sclerosis type, which was followed 11 years later by T-cell lymphoma with mesenteric localization. Such an association is extremely rare,14,15 and several hypotheses concerning the pathogenesis are discussed.

REPORT OF A CASE In January 1983, an adult white woman, born in 1951, was diagnosed as having Hodgkin’s disease, nodular sclerosis type II, subtype I (Bennett), clinical stage IIIA (supraclavicular bilateral, mediastinal and inguinal localization). The treatment associated four courses of MOPP (mechlorethamine, vincristine, procarbazine, and prednisone) with supradiaphragmatic and subdiaphragmatic radiotherapy. In June 1984, pruritus and splenomegaly led to the diagnosis of a relapse with identical histologic findings in the spleen and abdominal lymph nodes. The patient was treated with lomustine, procarbazine, and ABVD (doxorubicin, bleomycin, vinblastine, and adriamycin). In December 1989, a paravertebral relapse was treated with three courses of MEVAC (mitoguazone, etoposide, vindesine, adriamycin, and prednisone). Between 1990 and 1992, the patient’s treatment included chloraminophene, vinorelbine, and lomboaortic irradiation (30 Gy). A new laparotomy in April 1993 led to the discovery of residual foci of Hodgkin’s disease in the liver and a pleomorphic medium-sized T-cell lymphoma in gastrointestinal lymph nodes. Once again, MEVAC (three courses) was administered. In May 1994, the T-cell lymphoma invaded a submandibular lymph node. The patient received cyclophosphamide, vincristine, and prednisone. In July 1994, the patient died of pyocyanic pneumonia. No postmortem examination was possible. A passive particle agglutination test for human T-cell leukemia-lymphoma virus-1 antibodies was negative in December 1991.

MATERIALS AND METHODS Lymph node biopsies and spleen tissue samples from 1983 and 1984, respectively, were fixed for 24 hours in alcoholic Bouin’s fixative. More recent liver and lymph node biopsies were fixed in neutral formalin, alcoholic Bouin’s, and Lowy mercuric fixative, and a part was immediately snap-frozen in liquid nitrogen and stored at -70C. Routine staining included hematein-eosin-safranin, Masson’s trichrome, and May-Grnwald-Giesma stains.

The primary antibodies CD15, CD30, CD45RA, CD45RO, OPD4, and BNH9 were purchased from Immunotech (Marseille, France). Antibodies CD1, CD2, CD3, CD4, CDS, CD7, CD8, CD20, CD22, CD23, CD25, CD29, CD38, LMP1, EBNA2, DRC, 3F1, and Epstein-Barr virus-encoded RNA (EBER) probe were purchased from Dako Corp (Trappes France).

Immunohistochemical tests were performed as described classically using a Dako LSAB 2HRP kit (Dako Corp) for the second and third steps. Double Epstein-Barr virus (EBV) EBER in situ hybridization and immunolabeling used a Vectastain ABC kit pK 4002 (Vector, Biosys, Compiegne, France) for CD20 or CD3 primary antibody immunolabeling. Following a reaction with diaminobenzidine and hydrogen peroxide, the slides were kept in Tris sodium chloride (pH 5.6) for 1 to 24 hours before hybridization. In situ hybridization was performed following postfixation in paraformaldehyde (4%) in phosphate-buffered saline for 20 minutes at 4degC. Slides were then dehydrated twice in absolute ethanol for 10 minutes and dried in a dust-free medium for 30 to 40 minutes. The EBER probe (Dako oligonucleotide probe EBV EBERFITC Y0017), diluted 1:5 in hybridization medium (30 mu pL), was added to the slides, which were placed under coverslips and incubated for 2 hours at 50degC. Slides were then washed in standard saline citrate (SSC) (2 SSC for 20 minutes at 50degC, 0.5 SSC for 10 minutes at 50degC, and phosphate-buffered saline for 5 minutes at 22C). An anti-fluorescein isothiocyanate antibody coupled with alkaline phosphatase (Amersham anti-fluoresceine AP conjugate RPN 3311; Amersham, Les Ullis, France) was used for 60 minutes, reacting with a nitroblue tetrazolium complex under microscopic examination. The slides were quickly stained with hematoxylin and then mounted in an aqueous medium. The immunohistological labeling was strong (++), weak (+), or absent (0). go to site hodgkin s disease

High-molecular-weight DNA was isolated from frozen biopsies by sodium dodecylsulfate cell lysis, proteinase K digestion, phenol/chloroform extraction, and ethanol precipitation. Ten micrograms of DNA were digested with BamHI, EcoRI or HindIII restriction enzymes (Boehringer Mannheim, Meylan, France), separated by electrophoresis, and transferred onto Hybond N nylon membranes (Amersham, Little Chalfont, UK). Filters were hybridized with a T-cell receptor beta constant region probe and autoradiographed for 2 to 8 days.

Amplification of T-cell receptor gamma rearrangements was performed in three separate reactions. Briefly, for each reaction, 1 Wg of genomic DNA was amplified for 35 cycles, each cycle consisting of a denaturating step at 94degC for 45 seconds, a primer annealing step at 55C for 45 seconds, and an elongation step at 72degC for 45 seconds. The first reaction included oligonucleotide primer consensus for all Vyl family genes (CTGGTACCTACACCAGGAGGGGAA) and for JGammal and J gamma 2 gene segments (CCTGTGACAACAAGTGTTGT). The second reaction used the same V-Gamma l primer in association with specific JGamma P (TTGTTCCGGGACCAAATACC) and consensus JyPI and JGammaP2 (CCAGGTGAAGTTACTATGAG) primers. The third reaction included specific oligonucleotides for V Gamma 9 gene (GAAAGGAATCTGGCATTCCG), VGammalO gene (GCAGCATGGGATAGACAAGC), and V/Gamma lI gene (GATTGCTCAGGTGGGAAGAC) in association with all J gamma primers. The resulting polymerase chain reaction products were analyzed on 5% acrylamide gels after ethidium bromide staining.

A karyotype study was carried out on the submandibular T-cell lymphoma localization. The node fragment was dissociated with scalpels and the cells released were seeded in RPMI 1640 medium supplemented with 10% fetal calf serum. Metaphase preparations were obtained after 24-hour culture, using standard procedure. Chromosomes were analyzed after R-banding. A total of 15 metaphases could be examined.

RESULTS Immunohistochemical and molecular analyses are summarized in Table 2. The retrospective immunohistochemical study on Hodgkin’s samples (1983, 1984) confirmed the diagnosis of Hodgkin’s disease, nodular sclerosis type II, subtype I (Bennett), with typical CD15 and CD30 Hodgkin and Reed-Sternberg cells without EBV infection (Fig 1). T and B antigens were only demonstrated on reactive lymphocytes, which were associated with a few dendritic CD21-positive cells.

The liver biopsy (1993) associated typical nodular sclerosis Hodgkin’s foci (Fig 2) with reactive B and T cells and exceptional small reactive LMP1 EBER^sup +^ lymphocytes. Foci of liver T-cell lymphoma infiltration were also identified. The abdominal lymph node biopsies (1993) exhibited a typical, pleomorphic, medium-sized T-cell lymphoma (Fig 3) ^aup ++^ CD3^sup -+^ , CD4^sup +^ , CD5^sup +-^ , CD7^sup -+^ ^ , Beta F1^sup ++^ , CD45RO^sup ++^ , and OPD4^sup ++^ ). Tumor T cells (Fig 2) were negative for CDla, CD15, CD30, CD20, CD21, CD23, CD25, CD29, CD38, DRC1, BNH9, and CD57. Very rare LMP1^sup +^ and EBER^sup -^ medium-sized cells were demonstrated (1 in 10000). The submandibular tumor (1994) (Fig 4, a) expressed the same phenotype. In addition, a few LMP1 EBER^sup +^ cells (2%) were seen (Fig 4, b) (Table 2). Following combined hybridization and immunolabeling, such cells were EBER^sup+^ CD20+ and EBER^sup+^ CD3^sup -^ favoring their beta -cell nature. CD21^sup +^ residual dendritic cell foci on lymph node biopsies corresponded to atrophic germinal centers. Rare CDla^sup +^ and S100^sup +^ dendritic cells were also present. go to website hodgkin s disease

Identical clonal T-cell receptor gamma and Beta gene rearrangements were detected, respectively, by polymerase chain reaction and Southern blot in the 1993 and 1994 T-cell tumor samples. This confirmed both the monoclonal and, thereby, malignant origin of the tumor, as well as the similarity of the 1993 and 1994 samples.

The karyotype study identified a diploid clone with numerous and complex changes, including an isochromosome lq, a deletion lq, an isochromosome 7q, a deletion 11q, lack of chromosome 14, and other complex rearrangements preventing the recognition of a characteristic initial abnormality (Fig 5).

COMMENT This case documents sequential tumors occurring in the same patient.3 A typical Hodgkin’s disease, nodular sclerosis type, appeared first, followed by a typical, pleomorphic, medium-sized T-cell lymphoma. In 1993, Hodgkin’s infiltration in the liver showed tumor T-cell foci in some areas. Both diseases with specific phenotype were seen, and an overlap syndrome16,17 was never considered. Although such rare sequential malignancies make a statistical analysis difficult, Table 1 clearly shows that most T-cell lymphomas following Hodgkin’s disease occur after 2 years. Nodular sclerosis Hodgkin’s disease occurred in young patients in three cases (17, 18, and 18 years old). These three patients were affected by a T-cell lymphoma much later (89, 54, and 192 months) than the other cases cited in Table 1.

Patients with Hodgkin’s disease are at risk of developing second malignancies, especially leukemias and non-Hodgkin’s lymphomas, and this is in part favored by the treatment.4,5 The immunodeficiency related to Hodgkin’s disease is also thought to play a role in the development of second malignancies.1-4 A relationship with the treatment of the Hodgkin’s disease is not obvious in cases where initial treatment is minimals and the interval between the two diseases is short.2 However, for patients who have received long-term chemotherapy (with a classical increased risk of acute leukemia) and radiotherapy, the inductive effect of the treatment cannot be ruled out.1,3,11,15 Recently, the classical cumulative effect of chemotherapy, radiotherapy, and splenectomy for the occurrence of a second malignancy was reported in 892 cases of treated Hodgkin’s disease.4 Such patients exhibited an increased frequency of chromosomal translocation in peripheral blood lymphocytes.ls In six cases of nodular sclerosis Hodgkin’s disease reported in Table 1,9,10,14,15 the delay before onset of T-cell lymphoma varied from 1.5 to 16 years. All patients had received chemotherapy; three were given radiotherapy. Two patients underwent splenectomies in addition to chemotherapy and radiotherapy, as was the case in our patient. Splenectomy may also be an independent factor increasing the risk of second malignancies.4 In our case, no EBV infection was found retrospectively in the initial Hodgkin’s granuloma, and the direct tumorigenic effect of an EBV Hodgkin’s cell infection in the occurrence of second malignancy is unlikely.l,l9,20 In five B-cell lymphomas following nodular predominant Hodgkin’s disease, no EBV infection was demonstrated.21 Another study identified only two cases with EBV infection among 14 cases of sequential B-cell lymphomas following Hodgkin’s disease.7 In the rare cases of T-cell lymphoma following Hodgkin’s disease, no data are available concerning EBV infection. T-cell lymphomas with numerous EBV-infected cells are now clearly distinct from those containing only a few EBV-infected cells.21The significance of T-cell lymphomas with rare EBV-infected cells is unclear.23 Considering that infected EBV EBER+ cells may present a decreased phenotypic expression of B and T antigens,24,25 identification of their origin is difficult. Sparse EBV EBER- tumor cells may represent secondary infection of tumor cells.26 Rare EBV-infected cells may also be bystander B cells, now described in T-cell lymphoma with or without T-cell infection.27 Such B cells may look like immunoblasts and may be difficult to differentiate from tumor cells.27 In our observation, only B cells were clearly demonstrated as being infected by EBV, and there was no massive EBV tumor T-cell infection suggesting a direct causal effect on T-cell lymphoma development.22-24,26 However, T-cell stimulation by polyclonal EBV-infected B cells in an immunosuppressed patient cannot be ruled out as an indirect mechanism and first step in the genesis of a second malignancy.

Most sequential T-cell lymphomas behave very aggressively and have a fatal outcome within 1 to 13 months after diagnosis. Only two patients were reported alive 45 months later.2 As previously stressed,2 this case emphasizes the prominent role pathologic investigations play in the follow-up of patients treated for Hodgkin’s disease.

The authors thank V Molinie, MD, for providing the initial data (1983 and 1984), Kathleen McGee, MD, for help in editing the manuscript, and Jacques Diebold, MD, for helpful criticisms.

[Reference] References 1. Harris NL. The relationship between Hodgkin’s disease and non Hodgkin’s lymphoma. Semin Diagn Pathol.1992;9:304-310.

2. Bennett MH, Maclennan KA, Vaugham Hudson G, Vaugham Hudson B. Non Hodgkin’s lymphoma arising in patients treated for Hodgkin’s disease in the BNLI: a 20-year experience. Ann Oncol. 1991;2(suppl 2):83-92.

3. Jaffe ES, Zarate-Osorno A, Medeiros LJ. The interrelationship of Hodgkin’s disease and non Hodgkin’s lymphomas: lesions learned from composite and sequential malignancies. Semin Diagn Pathol. 1992;9:297-303.

4. Dietrich PY, Henry-Amar M, Cosset JM, et al. Second primary cancers in patients continuously disease free from Hodgkin’s disease: a protective role for the spleen? Blood.1994;84:1209-1215.

5. Van Leeuwen FE, Klockman WJ, Hagenbeek A, et al. Second cancer risk following Hodgkin’s disease. J Clin Oncol. 1994;12:312-325. 6. Casey TT, Cousar JB, Mangum M, et al. Monomorphic lymphoma arising in patients with Hodgkin’s disease. Am J Pathol.1990;136:81-94.

7. Kingma DW, Medeiros LJ, Barletta J, et al. Epstein-Barr virus is infrequently identified in non Hodgkin’s lymphomas associated with Hodgkin’s disease. AmJ Surg Pathol. 1994;18:48-61.

8. Tefferi A, Wiltsie JC, Kurtin PJ. Secondary T-cell lymphoma in the setting of nodular lymphocyte predominance Hodgkin’s disease. Am] Hematol. 1992;40: 232-233.

9. Wlodarska [, Delabie J, De Wolf-Peeters C, et al. T-cell lymphoma developing in Hodgkin's disease: evidence for two clones.jPathol. 1993;170:239248.

10. Gowin GT, Chan WC, Brynes RK, Heffner LT. T-cell lymphoma following Hodgkin's disease. Cancer. 1985;56:1191-1196.

11. Rysenga E, Linden MD, Carey JL, et al. Peripheral T-cell non-Hodgkin's lymphoma following treatment of nodular lymphocyte predominance Hodgkin's disease. Arch Pathol Lab Med. 1995;119:88-91.

12. Dick FR, Maca RD, Hankenson R. Hodgkin's disease terminating in a T cell immunoblastic leukemia. Cancer. 1978;42:1325-1329. 13. Boucheix C, Zittoun R, Reynes M, et al. Atypical T cell leukemia terminating in Hodgkin's disease. Cancer.1979;44:1403-1407.

14. Armitage JD, Dick FR, Goeken JA, et al. Second lymphoid malignant neoplasms occurring in patients treated for Hodgkin's disease. Arch Intern Med. 1983;143:445-450.

[Reference] 15. Lowenthal RM, Harlow RWH, Mead AE, Tuck D, Challis DR. T-cell non Hodgkin’s lymphoma after radiotherapy and chemotherapy for Hodgkin’s disease. Cancer. 1981;48:15861589.

16. Tosi P, Leoncini L, Del Vecchio MT, et al. Phenotypic overlaps between pleomorphic malignant T cell lymphomas and mixed cellularity Hodgkin’s disease. IntJ Cancer. 1992;52:202-207.

17. Banks PM. The distinction of Hodgkin’s disease from T cell lymphoma. Semin Diagn Pathol. 1992;9:279-283.

18. Smith LM, Evans JW, Mori M, Brown )M. The frequency of translocations after treatment for Hodgkin’s disease. Intl Radiat Oncol Biol Phys. 1992;24:737742.

19. Vassallo J, Brousset P, Knecht H, et al. Detection of Epstein-Barr virus in Hodgkin’s disease. Appl Immunohistochem.1993;1:213-219. 20. Masih A, Weisenburger D, Duggan M, et al. Epstein-Barr viral genome in lymph nodes from patients with Hodgkin’s disease may not be specific to ReedSternberg cells. Am J Pathol.1991;139:37-43.

21. Hansmann ML, Shibata D, Lorenzen ), et al. Incidence of Epstein-Barrvirus bc]2 expression and translocation t(14 18) in large cell lymphoma associated with paragranuloma (lymphocyte predominant Hodgkin’s disease). Hum Pathol. 1994;25:24*243.

22. De Bruin PC, liwa M, Oudejans JJ, et al. Presence of Epstein-Barr in extranodal T-cell lymphomas: differences in relation to site. Blood. 1994;83:16121618.

23. Zhou XG, Hamilton Dutoit Sl, Yan QH, Pallesen G. High frequency of Epstein-Barr virus in Chinese peripheral T-cell lymphoma. Histopathology 1994;24:115-122.

24. De Bruin PC, Jiwa NM, Van Der Valk P, et al. Detection of Epstein-Barr virus nucleic acid sequences and protein in nodal T -cell lymphomas: relation between latent membrane protein-1 positivity and clinical course. Histopathology. 1993;23:509-518.

25. Bai MC, )iwa NM, Horstman A, et al. Decreased expression of cellular markers in Epstein-Barr virus positive Hodgkin’s disease. J Pathol.1994;174:49Warning! OCR inputs differ greatly encoded RNA in non nasal/nasopharyngeal CD56 positive and CD56 negative T-cell Iymphomas. Tsang WY, Chan JK, Yip TT et al. In situ localization of Epstein-Barr virus encoded RNA in non nasal/nasopharyngeal CD56 positive and CD56 Frequent latent EpsteinBarr virus infection of neoplastic T-cells and bystander B cells in human Hum Pathol.1994;25:758-765.

27. Korbjuhn P Anagnodeficiency virus negative European peripheral pleomorphic I, Hummel M, et al. Frequent latent EpsteinBarr virus infection of neoplastic T-cells and bystander B cells in human immunodeficiency virus negative European peripheral pleomorphic T-cell lymphomas. Blood.1993;82217-223.

[Author Affiliation] Accepted for publication October 2, 1996. From the Service d’Anatomie Pathologique, Hopital V. Dupouy, Argenteuil, France (Dr Gaulier); Service d’Hematologie, Hopital L. Mourier, Colombes, France (Dr Teillet); Departement d’Hematologie, Hopital Pitie-Salpetriere, Paris, France (Dr Davi, Mr Laye); Laboratoire de Cytogenetique, Institut Curie, Paris, France (Dr Couturier); Service d’Hematologie Biologique, Hopital Avicenne, Bobigny, France (Dr Raphael).

Reprint requests to Service d’Anatomie Pathologique, Hopital Victor Dupouy, 95107 Argenteuil Cedex France (Dr Gaulier).

Alain Gaulier; Francoise Teillet; Frederic Davi; Jerome Couturier; et al